Human DUSP14 / MKP-6 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_007026.3

RefSeq ORF Size

642 bp

Gene Synonym

MKP6; MKP-L

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human dual specificity phosphatase 14 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

KpnI + XbaI(6kb+0.64kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dual specific phosphatase 14 / MAP-kinase phophatase-6 (DUSP14 / MKP6) is a member of Dual-specificity phosphatases that is a subclass of protein tyrosine phosphatases (PTP) families that can dephosphorylate bothe phosphotyrosine and phosphoserine / phosphothreonine residues in substrates. Unlike many other DUSPs, DUSP14 only contains a catalytic domain within the C-terminal region. In signal transduction, DUSP14 has been considered as negative regulator of the mitogen-activated protein kinase (MAPK) / extracellular signal-regulated kinase 1 / 2 (ERK 1 / 2) pathway. DUSP14 phosphatase activity has been confirmed to be inhibited by PTP inhibitor Ⅳ. PTP inhibitor binds to the catalytic site of DUSP14. PTP inhibitor Ⅳ effectively and specifically inhibited DUSP14-mediated dephosphorylation of JNK, a member of the mitogen-activated protein kinase (MAPK) family through dephosphorylation of both the Ser / Thr and Tyr residues of MAPKs.

References

Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.

Klinger S, et al. (2008) Increasing GLP-1-induced beta-cell proliferation by silencing the negative regulators of signaling cAMP response element modulator-alpha and DUSP14. Diabetes. 57 (3): 584-93.

Park JE, et al. (2009) PTP inhibitor IV protects JNK kinase activity by inhibiting dual-specificity phosphatase 14 (DUSP14). Biochem Biophys Res Commun. 387 (4): 795-9.

Catalog Number:HGC323-NO