Human DUSP14 / MKP-6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_007026.3

RefSeq ORF Size

642 bp

Gene Synonym

MKP6; MKP-L

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human dual specificity phosphatase 14 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

KpnI + XbaI(6kb+0.64kb)

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dual specific phosphatase 14 / MAP-kinase phophatase-6 (DUSP14 / MKP6) is a member of Dual-specificity phosphatases that is a subclass of protein tyrosine phosphatases (PTP) families that can dephosphorylate bothe phosphotyrosine and phosphoserine / phosphothreonine residues in substrates. Unlike many other DUSPs, DUSP14 only contains a catalytic domain within the C-terminal region. In signal transduction, DUSP14 has been considered as negative regulator of the mitogen-activated protein kinase (MAPK) / extracellular signal-regulated kinase 1 / 2 (ERK 1 / 2) pathway. DUSP14 phosphatase activity has been confirmed to be inhibited by PTP inhibitor Ⅳ. PTP inhibitor binds to the catalytic site of DUSP14. PTP inhibitor Ⅳ effectively and specifically inhibited DUSP14-mediated dephosphorylation of JNK, a member of the mitogen-activated protein kinase (MAPK) family through dephosphorylation of both the Ser / Thr and Tyr residues of MAPKs.

References

Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.

Klinger S, et al. (2008) Increasing GLP-1-induced beta-cell proliferation by silencing the negative regulators of signaling cAMP response element modulator-alpha and DUSP14. Diabetes. 57 (3): 584-93.

Park JE, et al. (2009) PTP inhibitor IV protects JNK kinase activity by inhibiting dual-specificity phosphatase 14 (DUSP14). Biochem Biophys Res Commun. 387 (4): 795-9.

Catalog Number:HGC323-CF