Human DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGC093-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
903bp
Gene Synonym
TNFRSF6B, M68, TR6, DCR3, DJ583P15.1.1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the tumor necrosis factor receptor superfamily. DcR3/TNFRSF6B belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. DcR3/TNFRSF6B is detected in fetal lung, brain and liver. DcR3/TNFRSF6B is also detected in adult stomach, spinal cord, lymph node, trachea, spleen, colon and lung. This protein is highly expressed in several primary tumors from colon, stomach, rectum, esophagus and in SW480 colon carcinoma cells.
References
  • Migone TS, et al. (2002) TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity. 16(3): 479-92.
  • Takahama Y, et al. (2002) The prognostic significance of overexpression of the decoy receptor for Fas ligand (DcR3) in patients with gastric carcinomas. Gastric Cancer. 5(2): 61-8.
  • Zhang J, et al. (2001) Modulation of T-cell responses to alloantigens by TR6/DcR3. J Clin Invest. 107(11): 1459-68.
  • TOP