Human DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_003823.2

RefSeq ORF Size

903bp

Gene Synonym

TNFRSF6B, M68, TR6, DCR3, DJ583P15.1.1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the tumor necrosis factor receptor superfamily. DcR3/TNFRSF6B belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. DcR3/TNFRSF6B is detected in fetal lung, brain and liver. DcR3/TNFRSF6B is also detected in adult stomach, spinal cord, lymph node, trachea, spleen, colon and lung. This protein is highly expressed in several primary tumors from colon, stomach, rectum, esophagus and in SW480 colon carcinoma cells.

References

Migone TS, et al. (2002) TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity. 16(3): 479-92.

Takahama Y, et al. (2002) The prognostic significance of overexpression of the decoy receptor for Fas ligand (DcR3) in patients with gastric carcinomas. Gastric Cancer. 5(2): 61-8.

Zhang J, et al. (2001) Modulation of T-cell responses to alloantigens by TR6/DcR3. J Clin Invest. 107(11): 1459-68.

Catalog Number:HGC093-CO