Human CSNK2A2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGB880-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053bp
Gene Synonym
CK2A2, CSNK2A1, FLJ43934
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human casein kinase 2, alpha prime polypeptide Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr protein kinase family and CK2 subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. The alpha and alpha' chains contain the catalytic site. CSNK2A2 is a tetramer composed of an alpha chain, an alpha' and two beta chains. It is also component of a CK2-SPT16-SSRP1 complex composed of SSRP1, SUPT16H, CSNK2A1, CSNK2A2 and CSNK2B, the complex associating following UV irradiation. Protein kinase casein kinase II (Ck2) is a cyclic-AMP and calcium-independent serine-threonine kinase that is composed of two catalytic subunits (alpha and alpha') and two regulatory beta-subunits. Ck2 is not a casein kinase in vivo, but over 100 substrates are known. The highly conserved amino acid sequences of its subunits and their broad expression suggest that Ck2 may have a fundamental role in cell function. Ck2 has been implicated in DNA replication, regulation of basal and inducible transcription, translation and control of metabolism. The Ck2alpha and Ck2alpha' isoforms (products of the genes Csnk2a1 and Csnk2a2, respectively) are highly homologous, the reason for their redundancy and evolutionary conservation is unknown. CSNK2A2 may be a candidate gene for these inherited syndromes.
References
  • Xu X. et al., 1999, Nat Genet. 23 (1):118-21.
  • Aasland M. et al., 2000, Anim Genet. 31 (2):131-4.
  • Escalier D. et al., 2003, Mol Reprod Dev. 66 (2):190-201.
  • Ackermann K. et al., 2005, Mol Cell Biochem. 274 (1-2):91-101.
  • TOP