Human CSNK2A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_001896.2

RefSeq ORF Size

1053bp

Gene Synonym

CK2A2, CSNK2A1, FLJ43934

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human casein kinase 2, alpha prime polypeptide Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr protein kinase family and CK2 subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. The alpha and alpha' chains contain the catalytic site. CSNK2A2 is a tetramer composed of an alpha chain, an alpha' and two beta chains. It is also component of a CK2-SPT16-SSRP1 complex composed of SSRP1, SUPT16H, CSNK2A1, CSNK2A2 and CSNK2B, the complex associating following UV irradiation. Protein kinase casein kinase II (Ck2) is a cyclic-AMP and calcium-independent serine-threonine kinase that is composed of two catalytic subunits (alpha and alpha') and two regulatory beta-subunits. Ck2 is not a casein kinase in vivo, but over 100 substrates are known. The highly conserved amino acid sequences of its subunits and their broad expression suggest that Ck2 may have a fundamental role in cell function. Ck2 has been implicated in DNA replication, regulation of basal and inducible transcription, translation and control of metabolism. The Ck2alpha and Ck2alpha' isoforms (products of the genes Csnk2a1 and Csnk2a2, respectively) are highly homologous, the reason for their redundancy and evolutionary conservation is unknown. CSNK2A2 may be a candidate gene for these inherited syndromes.

References

Xu X. et al., 1999, Nat Genet. 23 (1):118-21.

Aasland M. et al., 2000, Anim Genet. 31 (2):131-4.

Escalier D. et al., 2003, Mol Reprod Dev. 66 (2):190-201.

Ackermann K. et al., 2005, Mol Cell Biochem. 274 (1-2):91-101.

Catalog Number:HGB880-CF