Human CSNK2A2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGB880-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053bp
Gene Synonym
CK2A2, CSNK2A1, FLJ43934
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human casein kinase 2, alpha prime polypeptide Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr protein kinase family and CK2 subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. The alpha and alpha' chains contain the catalytic site. CSNK2A2 is a tetramer composed of an alpha chain, an alpha' and two beta chains. It is also component of a CK2-SPT16-SSRP1 complex composed of SSRP1, SUPT16H, CSNK2A1, CSNK2A2 and CSNK2B, the complex associating following UV irradiation. Protein kinase casein kinase II (Ck2) is a cyclic-AMP and calcium-independent serine-threonine kinase that is composed of two catalytic subunits (alpha and alpha') and two regulatory beta-subunits. Ck2 is not a casein kinase in vivo, but over 100 substrates are known. The highly conserved amino acid sequences of its subunits and their broad expression suggest that Ck2 may have a fundamental role in cell function. Ck2 has been implicated in DNA replication, regulation of basal and inducible transcription, translation and control of metabolism. The Ck2alpha and Ck2alpha' isoforms (products of the genes Csnk2a1 and Csnk2a2, respectively) are highly homologous, the reason for their redundancy and evolutionary conservation is unknown. CSNK2A2 may be a candidate gene for these inherited syndromes.
References
  • Xu X. et al., 1999, Nat Genet. 23 (1):118-21.
  • Aasland M. et al., 2000, Anim Genet. 31 (2):131-4.
  • Escalier D. et al., 2003, Mol Reprod Dev. 66 (2):190-201.
  • Ackermann K. et al., 2005, Mol Cell Biochem. 274 (1-2):91-101.
  • TOP