Human COMP Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_000095.2

RefSeq ORF Size

2274bp

Gene Synonym

COMP, MED, EDM1, EPD1, PSACH, THBS5, MGC131819, MGC149768

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cartilage oligomeric matrix protein Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.

References

Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.

Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.

Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.

Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.

Catalog Number:HGB754-NY