Human COMP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_000095.2

RefSeq ORF Size

2274bp

Gene Synonym

COMP, MED, EDM1, EPD1, PSACH, THBS5, MGC131819, MGC149768

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cartilage oligomeric matrix protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.

References

Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.

Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.

Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.

Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.

Catalog Number:HGB754-CM