Human COMP Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB754-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2274bp
Gene Synonym
COMP, MED, EDM1, EPD1, PSACH, THBS5, MGC131819, MGC149768
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cartilage oligomeric matrix protein Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.
References
  • Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.
  • Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.
  • Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.
  • Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.
  • TOP