Human CDKN2D/p19ink4d Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_079421.2

RefSeq ORF Size

501bp

Gene Synonym

p19; INK4D; p19-INK4D

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cyclin-dependent kinase inhibitor 2D(also known as CDKN2D or p19ink4d), a member of the INK4 family of cyclin-dependent kinase (CDK) inhibitors, negatively regulates the cyclin D-CDK4/6 complexes, which promote G1/S transition by phosphorylating the retinoblastoma tumor-suppressor gene product. It is clearly shown that DNA repair is the main target of p19ink4d effect and that diminished apoptosis is a downstream event. Experiments has uncovered a role of p19INK4d as a regulator of DNA-damage-induced apoptosis and suggest that it protects cells from undergoing apoptosis by allowing a more efficient DNA repair. It has been demonstrated that p19INK4d expression enhances cell survival under genotoxic conditions. Previous work has shown that inactivation of the cyclin-dependent kinase inhibitor (CKI) p19(Ink4d) leads to progressive hearing loss attributable to inappropriate DNA replication and subsequent apoptosis of hair cells. It may also involved in male reproductive function including testicular atrophy, alteration in serum follicle stimulating hormone, qualitative increase in germ cell apoptosis, and delayed kinetics of meiotic prophase markers.

References

Buchold GM, et al. (2007) Mice lacking cyclin-dependent kinase inhibitor p19Ink4d show strain-specific effects on male reproduction. Mol Reprod Dev. 74 (8): 1008-20.

Laine H, et al. (2007) p19(Ink4d) and p21(Cip1) collaborate to maintain the postmitotic state of auditory hair cells, their codeletion leading to DNA damage and p53-mediated apoptosis. J Neurosci. 27 (6): 1434-44.

Ceruti JM, et al. (2005) Induction of p19INK4d in response to ultraviolet light improves DNA repair and confers resistance to apoptosis in neuroblastoma cells. Oncogene. 24 (25): 4065-80.

Catalog Number:HGB469-NY