Human CDKN2D/p19ink4d Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGB469-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
501bp
Gene Synonym
p19; INK4D; p19-INK4D
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cyclin-dependent kinase inhibitor 2D(also known as CDKN2D or p19ink4d), a member of the INK4 family of cyclin-dependent kinase (CDK) inhibitors, negatively regulates the cyclin D-CDK4/6 complexes, which promote G1/S transition by phosphorylating the retinoblastoma tumor-suppressor gene product. It is clearly shown that DNA repair is the main target of p19ink4d effect and that diminished apoptosis is a downstream event. Experiments has uncovered a role of p19INK4d as a regulator of DNA-damage-induced apoptosis and suggest that it protects cells from undergoing apoptosis by allowing a more efficient DNA repair. It has been demonstrated that p19INK4d expression enhances cell survival under genotoxic conditions. Previous work has shown that inactivation of the cyclin-dependent kinase inhibitor (CKI) p19(Ink4d) leads to progressive hearing loss attributable to inappropriate DNA replication and subsequent apoptosis of hair cells. It may also involved in male reproductive function including testicular atrophy, alteration in serum follicle stimulating hormone, qualitative increase in germ cell apoptosis, and delayed kinetics of meiotic prophase markers. 
References
  • Buchold GM, et al. (2007) Mice lacking cyclin-dependent kinase inhibitor p19Ink4d show strain-specific effects on male reproduction. Mol Reprod Dev. 74 (8): 1008-20.
  • Laine H, et al. (2007) p19(Ink4d) and p21(Cip1) collaborate to maintain the postmitotic state of auditory hair cells, their codeletion leading to DNA damage and p53-mediated apoptosis. J Neurosci. 27 (6): 1434-44.
  • Ceruti JM, et al. (2005) Induction of p19INK4d in response to ultraviolet light improves DNA repair and confers resistance to apoptosis in neuroblastoma cells. Oncogene. 24 (25): 4065-80.
  • TOP