Human CDKN2D/p19ink4d Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGB469-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
501bp
Gene Synonym
p19; INK4D; p19-INK4D
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cyclin-dependent kinase inhibitor 2D(also known as CDKN2D or p19ink4d), a member of the INK4 family of cyclin-dependent kinase (CDK) inhibitors, negatively regulates the cyclin D-CDK4/6 complexes, which promote G1/S transition by phosphorylating the retinoblastoma tumor-suppressor gene product. It is clearly shown that DNA repair is the main target of p19ink4d effect and that diminished apoptosis is a downstream event. Experiments has uncovered a role of p19INK4d as a regulator of DNA-damage-induced apoptosis and suggest that it protects cells from undergoing apoptosis by allowing a more efficient DNA repair. It has been demonstrated that p19INK4d expression enhances cell survival under genotoxic conditions. Previous work has shown that inactivation of the cyclin-dependent kinase inhibitor (CKI) p19(Ink4d) leads to progressive hearing loss attributable to inappropriate DNA replication and subsequent apoptosis of hair cells. It may also involved in male reproductive function including testicular atrophy, alteration in serum follicle stimulating hormone, qualitative increase in germ cell apoptosis, and delayed kinetics of meiotic prophase markers. 
References
  • Buchold GM, et al. (2007) Mice lacking cyclin-dependent kinase inhibitor p19Ink4d show strain-specific effects on male reproduction. Mol Reprod Dev. 74 (8): 1008-20.
  • Laine H, et al. (2007) p19(Ink4d) and p21(Cip1) collaborate to maintain the postmitotic state of auditory hair cells, their codeletion leading to DNA damage and p53-mediated apoptosis. J Neurosci. 27 (6): 1434-44.
  • Ceruti JM, et al. (2005) Induction of p19INK4d in response to ultraviolet light improves DNA repair and confers resistance to apoptosis in neuroblastoma cells. Oncogene. 24 (25): 4065-80.
  • TOP