Human BTN3A1 / CD277 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGA894-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1542bp
Gene Synonym
BTF5, BT3.1, CD277
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human butyrophilin, subfamily 3, member A1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a family of seven BTN receptors encoded by genes in the MHC. BTN molecules are composed of two Ig domains (IgV, IgC2), a single transmembrane domain, and a large carboxyl-terminal domain termed B30.2 (or PRYSPRY) located in the cell cytoplasm. There are three human BTN3A loci, BTN3A1, BTN3A2, and BTN3A3, and clear orthologs of BTN3A molecules, now called CD277, are absent from the mouse genome. Despite its similarity to B7 molecules, BTN3A1 was proposed to act not as a coreceptor or costimulatory molecule, but rather to directly present pAg to the γδ TCR in a manner analogous to MHC-restricted peptide presentation. However, this model of BTN3A1 function has been challenged by conflicting data, which show pAg binding to a positively charged pocket in the cytosolic B30.2 domain, and that BTN3A1 does not directly engage the γδ TCR. This contradictory picture has emerged as a result of the complexity of the system and in particular by the use of endogenous and exogenous routes of Ag delivery in in vitro assays.
References
  • Rhodes DA, Chen H-C, Price AJ, et al. Activation of human γδ T cells by cytosolic interactions of BTN3A1 with soluble phosphoantigens and the cytoskeletal adaptor periplakin. Journal of immunology (Baltimore, Md : 1950). 2015;194(5):2390-2398.
  • TOP