Human BTN3A1 / CD277 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:HGA894-NG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1542bp
Gene Synonym
BTF5, BT3.1, CD277
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human butyrophilin, subfamily 3, member A1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a family of seven BTN receptors encoded by genes in the MHC. BTN molecules are composed of two Ig domains (IgV, IgC2), a single transmembrane domain, and a large carboxyl-terminal domain termed B30.2 (or PRYSPRY) located in the cell cytoplasm. There are three human BTN3A loci, BTN3A1, BTN3A2, and BTN3A3, and clear orthologs of BTN3A molecules, now called CD277, are absent from the mouse genome. Despite its similarity to B7 molecules, BTN3A1 was proposed to act not as a coreceptor or costimulatory molecule, but rather to directly present pAg to the γδ TCR in a manner analogous to MHC-restricted peptide presentation. However, this model of BTN3A1 function has been challenged by conflicting data, which show pAg binding to a positively charged pocket in the cytosolic B30.2 domain, and that BTN3A1 does not directly engage the γδ TCR. This contradictory picture has emerged as a result of the complexity of the system and in particular by the use of endogenous and exogenous routes of Ag delivery in in vitro assays.
References
  • Rhodes DA, Chen H-C, Price AJ, et al. Activation of human γδ T cells by cytosolic interactions of BTN3A1 with soluble phosphoantigens and the cytoskeletal adaptor periplakin. Journal of immunology (Baltimore, Md : 1950). 2015;194(5):2390-2398.
  • TOP