Human BTN3A1 / CD277 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

BC121800

RefSeq ORF Size

1542bp

Gene Synonym

BTF5, BT3.1, CD277

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human butyrophilin, subfamily 3, member A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a family of seven BTN receptors encoded by genes in the MHC. BTN molecules are composed of two Ig domains (IgV, IgC2), a single transmembrane domain, and a large carboxyl-terminal domain termed B30.2 (or PRYSPRY) located in the cell cytoplasm. There are three human BTN3A loci, BTN3A1, BTN3A2, and BTN3A3, and clear orthologs of BTN3A molecules, now called CD277, are absent from the mouse genome. Despite its similarity to B7 molecules, BTN3A1 was proposed to act not as a coreceptor or costimulatory molecule, but rather to directly present pAg to the γδ TCR in a manner analogous to MHC-restricted peptide presentation. However, this model of BTN3A1 function has been challenged by conflicting data, which show pAg binding to a positively charged pocket in the cytosolic B30.2 domain, and that BTN3A1 does not directly engage the γδ TCR. This contradictory picture has emerged as a result of the complexity of the system and in particular by the use of endogenous and exogenous routes of Ag delivery in in vitro assays.

References

Rhodes DA, Chen H-C, Price AJ, et al. Activation of human γδ T cells by cytosolic interactions of BTN3A1 with soluble phosphoantigens and the cytoskeletal adaptor periplakin. Journal of immunology (Baltimore, Md : 1950). 2015;194(5):2390-2398.

Catalog Number:HGA894-NO