Human BPI Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA857-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1464bp
Gene Synonym
rBPI, BPIFD1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human bactericidal/permeability-increasing protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which can be detected in the azurophilic granule and on the surface of polymorphonuclear leukocytes. Bactericidal/permeability-increasing protein also is a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. Bactericidal/permeability-increasing protein contains two domains that adopt the same structural fold, even though they have little sequence similarity. It binds to and neutralises lipopolysaccharides from the outer membrane of Gram-negative bacteria. The cytotoxic action of bactericidal/permeability-increasing protein is limited to many species of Gram-negative bacteria; this specificity may be explained by a strong affinity of the very basic N-terminal half for the negatively charged lipopolysaccharides that are unique to the Gram-negative bacterial outer envelope.
References
  • G Schlag, et al. (1999) Protective effect of bactericidal/permeability-increasing protein (rBPI21) in baboon sepsis is related to its antibacterial, not antiendotoxin, properties. Annals of Surgery. 229(2): 262-71.
  • Michael Levin, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal sepsis: a randomised trial. Lancet. 356 (9234):961-7.
  • Geraldine Canny, et al. (2002) Lipid mediator-induced expression of bactericidal/ permeability-increasing protein (BPI) in human mucosal epithelia. PNAS. 99(6):3902-7.
  • Elsbach, et al. (1998) The bactericidal/permeability-increasing protein (BPI) in antibacterial host defense (pdf). Journal of Leukocyte biology. 64(1):14-8.
  • TOP