Human BPI Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGA857-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1464bp
Gene Synonym
rBPI, BPIFD1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human bactericidal/permeability-increasing protein Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which can be detected in the azurophilic granule and on the surface of polymorphonuclear leukocytes. Bactericidal/permeability-increasing protein also is a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. Bactericidal/permeability-increasing protein contains two domains that adopt the same structural fold, even though they have little sequence similarity. It binds to and neutralises lipopolysaccharides from the outer membrane of Gram-negative bacteria. The cytotoxic action of bactericidal/permeability-increasing protein is limited to many species of Gram-negative bacteria; this specificity may be explained by a strong affinity of the very basic N-terminal half for the negatively charged lipopolysaccharides that are unique to the Gram-negative bacterial outer envelope.
References
  • G Schlag, et al. (1999) Protective effect of bactericidal/permeability-increasing protein (rBPI21) in baboon sepsis is related to its antibacterial, not antiendotoxin, properties. Annals of Surgery. 229(2): 262-71.
  • Michael Levin, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal sepsis: a randomised trial. Lancet. 356 (9234):961-7.
  • Geraldine Canny, et al. (2002) Lipid mediator-induced expression of bactericidal/ permeability-increasing protein (BPI) in human mucosal epithelia. PNAS. 99(6):3902-7.
  • Elsbach, et al. (1998) The bactericidal/permeability-increasing protein (BPI) in antibacterial host defense (pdf). Journal of Leukocyte biology. 64(1):14-8.
  • TOP