Human BPI Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC040955

RefSeq ORF Size

1464bp

Gene Synonym

rBPI, BPIFD1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human bactericidal/permeability-increasing protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which can be detected in the azurophilic granule and on the surface of polymorphonuclear leukocytes. Bactericidal/permeability-increasing protein also is a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. Bactericidal/permeability-increasing protein contains two domains that adopt the same structural fold, even though they have little sequence similarity. It binds to and neutralises lipopolysaccharides from the outer membrane of Gram-negative bacteria. The cytotoxic action of bactericidal/permeability-increasing protein is limited to many species of Gram-negative bacteria; this specificity may be explained by a strong affinity of the very basic N-terminal half for the negatively charged lipopolysaccharides that are unique to the Gram-negative bacterial outer envelope.

References

G Schlag, et al. (1999) Protective effect of bactericidal/permeability-increasing protein (rBPI21) in baboon sepsis is related to its antibacterial, not antiendotoxin, properties. Annals of Surgery. 229(2): 262-71.

Michael Levin, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal sepsis: a randomised trial. Lancet. 356 (9234):961-7.

Geraldine Canny, et al. (2002) Lipid mediator-induced expression of bactericidal/ permeability-increasing protein (BPI) in human mucosal epithelia. PNAS. 99(6):3902-7.

Elsbach, et al. (1998) The bactericidal/permeability-increasing protein (BPI) in antibacterial host defense (pdf). Journal of Leukocyte biology. 64(1):14-8.

Catalog Number:HGA857-CM