Human B3GNT6 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGA708-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1155bp
Gene Synonym
B3Gn-T6, IMAGE:4907098
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis of mucin-type O-glycans in digestive organs. It catalyzes the transfer of GlcNAc from UDP-GlcNAc to GalNAcalpha1-Ser/Thr (Tn antigen) to form the core 3 structure (GlcNAcbeta1-3GalNAcalpha1-Ser/Thr). Core 3 structure exists in O-glycan which is an important precursor in the biosynthesis of mucin-type glycoproteins. Loss of core 3 could lead to the production of secreted mucins, then bacteria would be inefficiently cleared from the system, and chronic inflammation would be developed, which eventually would result in development of cancer. B3GNT6 gene is a tumor suppressor gene.
References
  • Hennet T, et al. (1998) Genomic cloning and expression of three murine UDP-galactose: beta-N-acetylglucosamine beta1,3-galactosyltransferase genes. J Biol Chem. 273(1):58-65.
  • Kolbinger F, et al. (1998) Cloning of a human UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase catalyzing the formation of type 1 chains. J Biol Chem. 273(1): 433-40.
  • Henrissat B, et al. (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J. 326:929-39.
  • TOP