Human B3GNT6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGA708-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1155bp
Gene Synonym
B3Gn-T6, IMAGE:4907098
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis of mucin-type O-glycans in digestive organs. It catalyzes the transfer of GlcNAc from UDP-GlcNAc to GalNAcalpha1-Ser/Thr (Tn antigen) to form the core 3 structure (GlcNAcbeta1-3GalNAcalpha1-Ser/Thr). Core 3 structure exists in O-glycan which is an important precursor in the biosynthesis of mucin-type glycoproteins. Loss of core 3 could lead to the production of secreted mucins, then bacteria would be inefficiently cleared from the system, and chronic inflammation would be developed, which eventually would result in development of cancer. B3GNT6 gene is a tumor suppressor gene.
References
  • Hennet T, et al. (1998) Genomic cloning and expression of three murine UDP-galactose: beta-N-acetylglucosamine beta1,3-galactosyltransferase genes. J Biol Chem. 273(1):58-65.
  • Kolbinger F, et al. (1998) Cloning of a human UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase catalyzing the formation of type 1 chains. J Biol Chem. 273(1): 433-40.
  • Henrissat B, et al. (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J. 326:929-39.
  • TOP