Human B3GNT6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGA708-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1155bp
Gene Synonym
B3Gn-T6, IMAGE:4907098
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis of mucin-type O-glycans in digestive organs. It catalyzes the transfer of GlcNAc from UDP-GlcNAc to GalNAcalpha1-Ser/Thr (Tn antigen) to form the core 3 structure (GlcNAcbeta1-3GalNAcalpha1-Ser/Thr). Core 3 structure exists in O-glycan which is an important precursor in the biosynthesis of mucin-type glycoproteins. Loss of core 3 could lead to the production of secreted mucins, then bacteria would be inefficiently cleared from the system, and chronic inflammation would be developed, which eventually would result in development of cancer. B3GNT6 gene is a tumor suppressor gene.
References
  • Hennet T, et al. (1998) Genomic cloning and expression of three murine UDP-galactose: beta-N-acetylglucosamine beta1,3-galactosyltransferase genes. J Biol Chem. 273(1):58-65.
  • Kolbinger F, et al. (1998) Cloning of a human UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase catalyzing the formation of type 1 chains. J Biol Chem. 273(1): 433-40.
  • Henrissat B, et al. (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J. 326:929-39.
  • TOP