Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGA364-UT

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4425bp
Gene Synonym
CPAMD5, FWP007, S863-7, DKFZp779B086
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
alpha-2-macroglobulin, also known as α2-macroglobulin (α2M and A2M), is an abundant protein of the plasma of vertebrates and members of several invertebrate phyla and functions as a broad-spectrum protease-binding protein. alpha-2-macroglobulin is produced by the liver, and is a major component of the alpha-2 band in protein electrophoresis. alpha-2-macroglobulin is a large plasma glycoprotein that has long been known as an irreversible inhibitor of a variety of proteinases. More recently, it has been reported that numerous growth factors, cytokines and hormones bind to alpha 2M through diverse mechanisms. A2M is also produced in the brain where it binds multiple extracellular ligands and is internalized by neurons and astrocytes. In the brain of Alzheimer's disease (AD) patients, A2M has been localized to diffuse amyloid plaques. A2M also binds soluble beta-amyloid, of which it mediates degradation. Protease-conjugated alpha2-macroglobulin is selectively bound by cells contacting the body fluids and alpha2-macroglobulin and its protease cargo are then internalized and degraded in secondary lysosomes of those cells. In addition to this function as an agent for protease clearance, alpha2-macroglobulin binds a variety of other ligands, including several peptide growth factors and modulates the activity of a lectin-dependent cytolytic pathway in arthropods.
References
  • Kovacs DM. (2000) alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol. 35(4): 473-9.
  • Armstrong PB, et al. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 23(4-5): 375-90.
  • Feige JJ, et al. (1996) Alpha 2-macroglobulin: a binding protein for transforming growth factor-beta and various cytokines. Horm Res. 45(3-5): 227-32.
  • TOP