Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_000014.4

RefSeq ORF Size

4425bp

Gene Synonym

CPAMD5, FWP007, S863-7, DKFZp779B086

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

alpha-2-macroglobulin, also known as α2-macroglobulin (α2M and A2M), is an abundant protein of the plasma of vertebrates and members of several invertebrate phyla and functions as a broad-spectrum protease-binding protein. alpha-2-macroglobulin is produced by the liver, and is a major component of the alpha-2 band in protein electrophoresis. alpha-2-macroglobulin is a large plasma glycoprotein that has long been known as an irreversible inhibitor of a variety of proteinases. More recently, it has been reported that numerous growth factors, cytokines and hormones bind to alpha 2M through diverse mechanisms. A2M is also produced in the brain where it binds multiple extracellular ligands and is internalized by neurons and astrocytes. In the brain of Alzheimer's disease (AD) patients, A2M has been localized to diffuse amyloid plaques. A2M also binds soluble beta-amyloid, of which it mediates degradation. Protease-conjugated alpha2-macroglobulin is selectively bound by cells contacting the body fluids and alpha2-macroglobulin and its protease cargo are then internalized and degraded in secondary lysosomes of those cells. In addition to this function as an agent for protease clearance, alpha2-macroglobulin binds a variety of other ligands, including several peptide growth factors and modulates the activity of a lectin-dependent cytolytic pathway in arthropods.

References

Kovacs DM. (2000) alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol. 35(4): 473-9.

Armstrong PB, et al. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 23(4-5): 375-90.

Feige JJ, et al. (1996) Alpha 2-macroglobulin: a binding protein for transforming growth factor-beta and various cytokines. Horm Res. 45(3-5): 227-32.

Catalog Number:HGA364-NO