Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_000014.4

RefSeq ORF Size

4425bp

Gene Synonym

CPAMD5, FWP007, S863-7, DKFZp779B086

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human alpha-2-macroglobulin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

alpha-2-macroglobulin, also known as α2-macroglobulin (α2M and A2M), is an abundant protein of the plasma of vertebrates and members of several invertebrate phyla and functions as a broad-spectrum protease-binding protein. alpha-2-macroglobulin is produced by the liver, and is a major component of the alpha-2 band in protein electrophoresis. alpha-2-macroglobulin is a large plasma glycoprotein that has long been known as an irreversible inhibitor of a variety of proteinases. More recently, it has been reported that numerous growth factors, cytokines and hormones bind to alpha 2M through diverse mechanisms. A2M is also produced in the brain where it binds multiple extracellular ligands and is internalized by neurons and astrocytes. In the brain of Alzheimer's disease (AD) patients, A2M has been localized to diffuse amyloid plaques. A2M also binds soluble beta-amyloid, of which it mediates degradation. Protease-conjugated alpha2-macroglobulin is selectively bound by cells contacting the body fluids and alpha2-macroglobulin and its protease cargo are then internalized and degraded in secondary lysosomes of those cells. In addition to this function as an agent for protease clearance, alpha2-macroglobulin binds a variety of other ligands, including several peptide growth factors and modulates the activity of a lectin-dependent cytolytic pathway in arthropods.

References

Kovacs DM. (2000) alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol. 35(4): 473-9.

Armstrong PB, et al. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 23(4-5): 375-90.

Feige JJ, et al. (1996) Alpha 2-macroglobulin: a binding protein for transforming growth factor-beta and various cytokines. Horm Res. 45(3-5): 227-32.

Catalog Number:HGA364-CM