Human AIM2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_004833.1

RefSeq ORF Size

1032bp

Gene Synonym

PYHIN4, AIM2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human absent in melanoma 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.

References

Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.

Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.

Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.

Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.

Catalog Number:HGA277-NF