Human AIM2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGA277-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
PYHIN4, AIM2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human absent in melanoma 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.
References
  • Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.
  • Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.
  • Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.
  • Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.
  • TOP