Human AIM2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_004833.1

RefSeq ORF Size

1032bp

Gene Synonym

PYHIN4, AIM2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human absent in melanoma 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.

References

Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.

Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.

Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.

Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.

Catalog Number:HGA277-CY