Human Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_023928.3

RefSeq ORF Size

2019bp

Gene Synonym

ACSF1, SUR-5, FLJ12389, FLJ41251, AACS

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human acetoacetyl-CoA synthetase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

References

Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.

Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.

Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.

Catalog Number:HGA132-NM