Human Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGA132-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2019bp
Gene Synonym
ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acetoacetyl-CoA synthetase Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.
References
  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • TOP