Human Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA132-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2019bp
Gene Synonym
ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acetoacetyl-CoA synthetase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.
References
  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • TOP