Human AARS / alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGA067-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2907bp
Gene Synonym
AARS
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alanyl-tRNA synthetase (AARS) belongs to the family of ligases, specifically those forming carbon-oxygen bonds in aminoacyl-tRNA and related compounds. This enzyme participates in alanine and aspartate metabolism and aminoacyl-tRNA biosynthesis. Alanyl-tRNA synthetase (AlaRS) catalyzes synthesis of Ala-tRNA (Ala) and hydrolysis of mis-acylated Ser- and Gly-tRNA (Ala) at 2 different catalytic sites. Their role is not confined to catalyze the attachment of amino acids to transfer RNAs and thereby establish the rules of genetic code by virtue of matching the nucleotide triplet of anticodon with cognate amino acid. Under apoptotic conditions in cell culture, the full-length enzyme is secreted, and the two cytokine activities can be generated by leukocyte elastase, an extracellular protease. Secretion of this tRNA synthetase may contribute to apoptosis both by arresting translation and producing needed cytokines. This protein could be an attractive target of drugs against bacterial, fungal and parasitic infections. 
References
  • Wakasugi K, et al. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284 (5411): 147-51.
  • Sokabe M, et al. (2009) The structure of alanyl-tRNA synthetase with editing domain. Proc Natl Acad Sci . 106 (27): 11028-33.
  • Skupinska M, et al. (2009) AARS--the etiological factor and the attractive target of many disorders. Postepy Biochem. 55 (4): 373-84.
  • TOP