Human AARS / alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGA067-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2907bp
Gene Synonym
AARS
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alanyl-tRNA synthetase (AARS) belongs to the family of ligases, specifically those forming carbon-oxygen bonds in aminoacyl-tRNA and related compounds. This enzyme participates in alanine and aspartate metabolism and aminoacyl-tRNA biosynthesis. Alanyl-tRNA synthetase (AlaRS) catalyzes synthesis of Ala-tRNA (Ala) and hydrolysis of mis-acylated Ser- and Gly-tRNA (Ala) at 2 different catalytic sites. Their role is not confined to catalyze the attachment of amino acids to transfer RNAs and thereby establish the rules of genetic code by virtue of matching the nucleotide triplet of anticodon with cognate amino acid. Under apoptotic conditions in cell culture, the full-length enzyme is secreted, and the two cytokine activities can be generated by leukocyte elastase, an extracellular protease. Secretion of this tRNA synthetase may contribute to apoptosis both by arresting translation and producing needed cytokines. This protein could be an attractive target of drugs against bacterial, fungal and parasitic infections. 
References
  • Wakasugi K, et al. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284 (5411): 147-51.
  • Sokabe M, et al. (2009) The structure of alanyl-tRNA synthetase with editing domain. Proc Natl Acad Sci . 106 (27): 11028-33.
  • Skupinska M, et al. (2009) AARS--the etiological factor and the attractive target of many disorders. Postepy Biochem. 55 (4): 373-84.
  • TOP