Human AARS / alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_001605.2

RefSeq ORF Size

2907bp

Gene Synonym

AARS

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human alanyl-tRNA synthetase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Alanyl-tRNA synthetase (AARS) belongs to the family of ligases, specifically those forming carbon-oxygen bonds in aminoacyl-tRNA and related compounds. This enzyme participates in alanine and aspartate metabolism and aminoacyl-tRNA biosynthesis. Alanyl-tRNA synthetase (AlaRS) catalyzes synthesis of Ala-tRNA (Ala) and hydrolysis of mis-acylated Ser- and Gly-tRNA (Ala) at 2 different catalytic sites. Their role is not confined to catalyze the attachment of amino acids to transfer RNAs and thereby establish the rules of genetic code by virtue of matching the nucleotide triplet of anticodon with cognate amino acid. Under apoptotic conditions in cell culture, the full-length enzyme is secreted, and the two cytokine activities can be generated by leukocyte elastase, an extracellular protease. Secretion of this tRNA synthetase may contribute to apoptosis both by arresting translation and producing needed cytokines. This protein could be an attractive target of drugs against bacterial, fungal and parasitic infections.

References

Wakasugi K, et al. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284 (5411): 147-51.

Sokabe M, et al. (2009) The structure of alanyl-tRNA synthetase with editing domain. Proc Natl Acad Sci . 106 (27): 11028-33.

Skupinska M, et al. (2009) AARS--the etiological factor and the attractive target of many disorders. Postepy Biochem. 55 (4): 373-84.

Catalog Number:HGA067-CM