Rhesus TRAIL R4/CD264/TNFRSF10D Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGI001-NF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1149bp
Gene Synonym
TNFRSF10D
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL R4), CD264, and Decoy receptor 2, is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. TRAIL R4/CD264/TNFRSF10D is widely expressed, in particular in fetal kidney, lung and liver, and in adult testis and liver. TRAIL R4/CD264/TNFRSF10D is also expressed in peripheral blood leukocytes, colon and small intestine, ovary, prostate, thymus, spleen, pancreas, kidney, lung, placenta and heart. The signaling capacity of TRAIL R4 is similar to that of TRAIL R1 and TRAIL R2 with respect to NF-κB activation, but differs in its inability to induce apoptosis. TRAIL R4 retains a C-terminal element containing one third of a consensus death domain motif. Transient overexpression of TRAIL R4 in cells normally sensitive to TRAIL-mediated killing confers complete protection, suggesting that one function of TRAIL R4 may be inhibition of TRAIL cytotoxicity.
References
  • Degli-Esposti MA, et al. (1997) The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity. 7(6): 813-20.
  • Meng RD, et al. (2000) The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther. 1(2): 130-44.
  • Bouralexis S, et al. (2003) Progressive resistance of BTK-143 osteosarcoma cells to Apo2L/TRAIL-induced apoptosis is mediated by acquisition of DcR2/TRAIL-R4 expression: resensitisation with chemotherapy. Br J Cancer. 89(1): 206-14.
  • TOP