Rhesus TRAIL R4/CD264/TNFRSF10D Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001107922.1

RefSeq ORF Size

1149bp

Gene Synonym

TNFRSF10D

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL R4), CD264, and Decoy receptor 2, is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. TRAIL R4/CD264/TNFRSF10D is widely expressed, in particular in fetal kidney, lung and liver, and in adult testis and liver. TRAIL R4/CD264/TNFRSF10D is also expressed in peripheral blood leukocytes, colon and small intestine, ovary, prostate, thymus, spleen, pancreas, kidney, lung, placenta and heart. The signaling capacity of TRAIL R4 is similar to that of TRAIL R1 and TRAIL R2 with respect to NF-κB activation, but differs in its inability to induce apoptosis. TRAIL R4 retains a C-terminal element containing one third of a consensus death domain motif. Transient overexpression of TRAIL R4 in cells normally sensitive to TRAIL-mediated killing confers complete protection, suggesting that one function of TRAIL R4 may be inhibition of TRAIL cytotoxicity.

References

Degli-Esposti MA, et al. (1997) The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity. 7(6): 813-20.

Meng RD, et al. (2000) The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther. 1(2): 130-44.

Bouralexis S, et al. (2003) Progressive resistance of BTK-143 osteosarcoma cells to Apo2L/TRAIL-induced apoptosis is mediated by acquisition of DcR2/TRAIL-R4 expression: resensitisation with chemotherapy. Br J Cancer. 89(1): 206-14.

Catalog Number:CGI001-CY