Rhesus TRAIL R4/CD264/TNFRSF10D Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:CGI001-CM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1149bp
Gene Synonym
TNFRSF10D
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL R4), CD264, and Decoy receptor 2, is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. TRAIL R4/CD264/TNFRSF10D is widely expressed, in particular in fetal kidney, lung and liver, and in adult testis and liver. TRAIL R4/CD264/TNFRSF10D is also expressed in peripheral blood leukocytes, colon and small intestine, ovary, prostate, thymus, spleen, pancreas, kidney, lung, placenta and heart. The signaling capacity of TRAIL R4 is similar to that of TRAIL R1 and TRAIL R2 with respect to NF-κB activation, but differs in its inability to induce apoptosis. TRAIL R4 retains a C-terminal element containing one third of a consensus death domain motif. Transient overexpression of TRAIL R4 in cells normally sensitive to TRAIL-mediated killing confers complete protection, suggesting that one function of TRAIL R4 may be inhibition of TRAIL cytotoxicity.
References
  • Degli-Esposti MA, et al. (1997) The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity. 7(6): 813-20.
  • Meng RD, et al. (2000) The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther. 1(2): 130-44.
  • Bouralexis S, et al. (2003) Progressive resistance of BTK-143 osteosarcoma cells to Apo2L/TRAIL-induced apoptosis is mediated by acquisition of DcR2/TRAIL-R4 expression: resensitisation with chemotherapy. Br J Cancer. 89(1): 206-14.
  • TOP