Rhesus IGFBP-2 / IGFBP2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001087071.2

RefSeq ORF Size

981bp

Gene Synonym

IGFBP2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus insulin-like growth factor binding protein 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IGFBP-2, also known as IGFBP2, is a insulin-like growth factor-binding protein (IGFBP). IGFBPs prolong the half-life of the IGFs , control bioavailability, activity, and distribution of insulin-like growth factor (IGF) through high-affinity IGFBP/IGF complexes. Six high-affinity IGF-binding proteins (IGFBP-1 to -6) have been identified. The six IGFBPs are structurally related but encoded by distinct genes. IGFBPs have a high affinity for IGFs. Some members of the IGFBP family have been consistently shown to inhibit IGF actions by preventing them from gaining access to the IGF receptors, while others potentiate IGF actions by facilitating the ligand-receptor interaction. IGFBP-2 is overexpressed in many malignancies and is often correlated with an increasingly malignant status of the tumor, pointing to a potential involvement of IGFBP-2 in tumorigenesis. It contains 1 IGFBP N-terminal domain and 1 thyroglobulin type-1 domain. It inhibits IGF-mediated growth and developmental rates.

References

Han VK, et al. (1996) The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 81(7): 2680-93.

Binkert C, et al. (1989) Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2) . EMBO J. 8(9):2497-502.

Wolf E, et al. (2000) Effects of IGFBP-2 overexpression in vitro and in vivo. Pediatr Nephrol. 14 (7):572-8.

Catalog Number:CGD840-NO