Rhesus IGFBP-2 / IGFBP2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001087071.2

RefSeq ORF Size

981bp

Gene Synonym

IGFBP2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus insulin-like growth factor binding protein 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IGFBP-2, also known as IGFBP2, is a insulin-like growth factor-binding protein (IGFBP). IGFBPs prolong the half-life of the IGFs , control bioavailability, activity, and distribution of insulin-like growth factor (IGF) through high-affinity IGFBP/IGF complexes. Six high-affinity IGF-binding proteins (IGFBP-1 to -6) have been identified. The six IGFBPs are structurally related but encoded by distinct genes. IGFBPs have a high affinity for IGFs. Some members of the IGFBP family have been consistently shown to inhibit IGF actions by preventing them from gaining access to the IGF receptors, while others potentiate IGF actions by facilitating the ligand-receptor interaction. IGFBP-2 is overexpressed in many malignancies and is often correlated with an increasingly malignant status of the tumor, pointing to a potential involvement of IGFBP-2 in tumorigenesis. It contains 1 IGFBP N-terminal domain and 1 thyroglobulin type-1 domain. It inhibits IGF-mediated growth and developmental rates.

References

Han VK, et al. (1996) The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 81(7): 2680-93.

Binkert C, et al. (1989) Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2) . EMBO J. 8(9):2497-502.

Wolf E, et al. (2000) Effects of IGFBP-2 overexpression in vitro and in vivo. Pediatr Nephrol. 14 (7):572-8.

Catalog Number:CGD840-CY