Rhesus IGFBP-2 / IGFBP2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGD840-CF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
981bp
Gene Synonym
IGFBP2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus insulin-like growth factor binding protein 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IGFBP-2, also known as IGFBP2, is a insulin-like growth factor-binding protein (IGFBP). IGFBPs prolong the half-life of the IGFs , control bioavailability, activity, and distribution of insulin-like growth factor (IGF) through high-affinity IGFBP/IGF complexes. Six high-affinity IGF-binding proteins (IGFBP-1 to -6) have been identified. The six IGFBPs are structurally related but encoded by distinct genes. IGFBPs have a high affinity for IGFs. Some members of the IGFBP family have been consistently shown to inhibit IGF actions by preventing them from gaining access to the IGF receptors, while others potentiate IGF actions by facilitating the ligand-receptor interaction. IGFBP-2 is overexpressed in many malignancies and is often correlated with an increasingly malignant status of the tumor, pointing to a potential involvement of IGFBP-2 in tumorigenesis. It contains 1 IGFBP N-terminal domain and 1 thyroglobulin type-1 domain. It inhibits IGF-mediated growth and developmental rates.
References
  • Han VK, et al. (1996) The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 81(7): 2680-93.
  • Binkert C, et al. (1989) Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2) . EMBO J. 8(9):2497-502.
  • Wolf E, et al. (2000) Effects of IGFBP-2 overexpression in vitro and in vivo. Pediatr Nephrol. 14 (7):572-8.
  • TOP