HIV-1 (group M, CRF07_BC) GP120 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:VGD603-CY

Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
1521bp
Gene Synonym
gp120
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV HIV-1 GP120 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of the virus, which is an essential component in the multi-tiered viral entry process. It presents itself as viral membrane spikes consisting of 3 molecules of gp120 linked together and anchored to the membrane by gp41 protein. Gp120 is essential for viral infection as it facilitates HIV entry into the host cell and this is its best-known and most researched role in HIV infection. However, it is becoming increasingly evident that gp120 might also be facilitating viral persistence and continuing HIV infection by influencing the T cell immune response to the virus. The surface protein gp120 attaches the virus to the host lymphoid cell by binding to the primary receptor CD4. Gp120 binding to its receptor CD4 and co-receptor, CXCR4 or CCR5 is required for fusion of viral and cellular membranes. Several mechanisms might be involved in this process of which gp120 binding to the CD4 receptor of T cells is the best known and most important interaction as it facilitates viral entry into the CD4+ cells and their depletion, a hallmark of the HIV infection. Gp120 is shed from the viral membrane and accumulates in lymphoid tissues in significant amounts. Despite the overall genetic heterogeneity of the gp120 glycoprotein, the conserved CD4 binding site provides an attractive antiviral target. Interaction between gp120 and ITGA4/ITGB7 would allow the virus to enter GALT early in the infection, infecting and killing most of GALT's resting CD4+ T-cells. This T-cell depletion is believed to be the major insult to the host immune system leading to AIDS.
References
  • Kadow J, et al. (2006) Small-molecule HIV-1 gp120 inhibitors to prevent HIV-1 entry: an emerging opportunity for drug development. Curr Opin Investig Drugs. 7(8): 721-6.
  • Stevceva L, et al. (2007) Immune responses to HIV Gp120 that facilitate viral escape. Curr HIV Res. 5(1): 47-54.
  • Yoon V, et al. (2010) The GP120 molecule of HIV-1 and its interaction with T cells. Curr Med Chem. 17(8): 741-9.
  • TOP