HIV-1 (group M, CRF07_BC) GP120 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:VGD603-CM

Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
1521bp
Gene Synonym
gp120
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV HIV-1 GP120 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of the virus, which is an essential component in the multi-tiered viral entry process. It presents itself as viral membrane spikes consisting of 3 molecules of gp120 linked together and anchored to the membrane by gp41 protein. Gp120 is essential for viral infection as it facilitates HIV entry into the host cell and this is its best-known and most researched role in HIV infection. However, it is becoming increasingly evident that gp120 might also be facilitating viral persistence and continuing HIV infection by influencing the T cell immune response to the virus. The surface protein gp120 attaches the virus to the host lymphoid cell by binding to the primary receptor CD4. Gp120 binding to its receptor CD4 and co-receptor, CXCR4 or CCR5 is required for fusion of viral and cellular membranes. Several mechanisms might be involved in this process of which gp120 binding to the CD4 receptor of T cells is the best known and most important interaction as it facilitates viral entry into the CD4+ cells and their depletion, a hallmark of the HIV infection. Gp120 is shed from the viral membrane and accumulates in lymphoid tissues in significant amounts. Despite the overall genetic heterogeneity of the gp120 glycoprotein, the conserved CD4 binding site provides an attractive antiviral target. Interaction between gp120 and ITGA4/ITGB7 would allow the virus to enter GALT early in the infection, infecting and killing most of GALT's resting CD4+ T-cells. This T-cell depletion is believed to be the major insult to the host immune system leading to AIDS.
References
  • Kadow J, et al. (2006) Small-molecule HIV-1 gp120 inhibitors to prevent HIV-1 entry: an emerging opportunity for drug development. Curr Opin Investig Drugs. 7(8): 721-6.
  • Stevceva L, et al. (2007) Immune responses to HIV Gp120 that facilitate viral escape. Curr HIV Res. 5(1): 47-54.
  • Yoon V, et al. (2010) The GP120 molecule of HIV-1 and its interaction with T cells. Curr Med Chem. 17(8): 741-9.
  • TOP