Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

H1N1

NCBI Ref Seq

AF389122.1

RefSeq ORF Size

693bp

Gene Synonym

NS1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of H1N1 Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

References

Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.

Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.

Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.

Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7

Catalog Number:VGD383-NM