Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

H1N1

NCBI Ref Seq

AF389122.1

RefSeq ORF Size

693bp

Gene Synonym

NS1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of H1N1 Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

References

Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.

Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.

Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.

Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7

Catalog Number:VGD383-CY