Rat Podoplanin Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_019358.1

RefSeq ORF Size

501bp

Gene Synonym

E11, Gp38, OTS-8, RTI40, T1-alpha

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat podoplanin Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.

References

Kimura, N. et al., 2005, Pathol Int. 55 (2): 83-86.

Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.

Wicki, A. et al., 2007, Br. J. Cancer. 96 (1): 1-5.

Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.

Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.

Kaddu, S. et al., 2009, Am J Dermatopathol. 31 (2): 137-139.

Catalog Number:RGF970-NY