Rat Podoplanin Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGF970-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
501bp
Gene Synonym
E11, Gp38, OTS-8, RTI40, T1-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat podoplanin Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.
References
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • TOP