Rat OBCAM/OPCML Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGF458-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1038bp
Gene Synonym
Opcml
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat opioid binding protein/cell adhesion molecule-like Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).
References
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • TOP