Rat OBCAM/OPCML Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGF458-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1038bp
Gene Synonym
Opcml
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat opioid binding protein/cell adhesion molecule-like Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).
References
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • TOP