Rat NKG2D/CD314/KLRK1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGF295-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
648bp
Gene Synonym
NKG2D, Nkrp2, Klrk1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat killer cell lectin-like receptor subfamily K, member 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.
References
  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • TOP