Rat NKG2D/CD314/KLRK1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGF295-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
648bp
Gene Synonym
NKG2D, Nkrp2, Klrk1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat killer cell lectin-like receptor subfamily K, member 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.
References
  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • TOP